DNA Mutation

If you liked this item, please rate it up on Steam Workshop page.

Author: BigCrunch

Last revision: 26 Nov, 2021 at 02:48 UTC

File size: 2.14 MB

On Steam Workshop

Description:

"GATCGATTCGATCGATGCTAGC…"

Idea – Serum
Implementer – BigCrunch22

TP Supported!

If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.